Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   GTW28_RS02155 Genome accession   NZ_CP047485
Coordinates   421019..421141 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain BJQ0005     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 416019..426141
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  GTW28_RS02140 (GTW28_02140) yclJ 417633..418316 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  GTW28_RS02145 (GTW28_02145) yclK 418303..419724 (+) 1422 WP_074794501.1 two-component system sensor histidine kinase YclK -
  GTW28_RS02150 (GTW28_02150) rapC 419887..421035 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  GTW28_RS02155 (GTW28_02155) phrC 421019..421141 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  GTW28_RS02160 (GTW28_02160) yczM 421241..421330 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  GTW28_RS02165 (GTW28_02165) yczN 421412..421525 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  GTW28_RS02170 (GTW28_02170) thrD 421678..423042 (-) 1365 WP_015715246.1 aspartate kinase -
  GTW28_RS02175 (GTW28_02175) ceuB 423427..424377 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  GTW28_RS02180 (GTW28_02180) yclO 424370..425317 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  GTW28_RS02185 (GTW28_02185) yclP 425311..426069 (+) 759 WP_046380785.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=413647 GTW28_RS02155 WP_003224994.1 421019..421141(+) (phrC) [Bacillus subtilis strain BJQ0005]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=413647 GTW28_RS02155 WP_003224994.1 421019..421141(+) (phrC) [Bacillus subtilis strain BJQ0005]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment