Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   GSY53_RS09965 Genome accession   NZ_CP047325
Coordinates   1943422..1943544 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain GOT9     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 1938422..1948544
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  GSY53_RS09950 (GSY53_09950) yclJ 1940036..1940719 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  GSY53_RS09955 (GSY53_09955) yclK 1940706..1942127 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  GSY53_RS09960 (GSY53_09960) rapC 1942290..1943438 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  GSY53_RS09965 (GSY53_09965) phrC 1943422..1943544 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  GSY53_RS09970 (GSY53_09970) yczM 1943644..1943733 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  GSY53_RS09975 (GSY53_09975) yczN 1943815..1943928 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  GSY53_RS09980 (GSY53_09980) thrD 1944082..1945446 (-) 1365 WP_003234493.1 aspartate kinase -
  GSY53_RS09985 (GSY53_09985) ceuB 1945831..1946781 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  GSY53_RS09990 (GSY53_09990) yclO 1946774..1947721 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  GSY53_RS09995 (GSY53_09995) yclP 1947715..1948473 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=412709 GSY53_RS09965 WP_003224994.1 1943422..1943544(+) (phrC) [Bacillus subtilis strain GOT9]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=412709 GSY53_RS09965 WP_003224994.1 1943422..1943544(+) (phrC) [Bacillus subtilis strain GOT9]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment