Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   GO005_RS02520 Genome accession   NZ_CP046592
Coordinates   484207..484329 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain TR21     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 479207..489329
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  GO005_RS02505 (GO005_02490) yclJ 480821..481504 (+) 684 WP_032722955.1 two-component system response regulator YclJ -
  GO005_RS02510 (GO005_02495) yclK 481491..482912 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  GO005_RS02515 (GO005_02500) rapC 483075..484223 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  GO005_RS02520 (GO005_02505) phrC 484207..484329 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  GO005_RS02525 (GO005_02510) yczM 484429..484518 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  GO005_RS02530 (GO005_02515) yczN 484600..484713 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  GO005_RS02535 (GO005_02520) thrD 484866..486230 (-) 1365 WP_015715246.1 aspartate kinase -
  GO005_RS02540 (GO005_02525) ceuB 486615..487565 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  GO005_RS02545 (GO005_02530) yclO 487558..488505 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  GO005_RS02550 (GO005_02535) yclP 488499..489257 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=405846 GO005_RS02520 WP_003224994.1 484207..484329(+) (phrC) [Bacillus subtilis strain TR21]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=405846 GO005_RS02520 WP_003224994.1 484207..484329(+) (phrC) [Bacillus subtilis strain TR21]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment