Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   GO004_RS11905 Genome accession   NZ_CP046591
Coordinates   2255533..2255655 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain R31     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 2250533..2260655
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  GO004_RS11875 (GO004_11865) yclP 2250605..2251363 (-) 759 WP_195727644.1 petrobactin ABC transporter ATP-binding protein YclP -
  GO004_RS11880 (GO004_11870) yclO 2251357..2252304 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  GO004_RS11885 (GO004_11875) ceuB 2252297..2253247 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  GO004_RS11890 (GO004_11880) thrD 2253632..2254996 (+) 1365 WP_029726569.1 aspartate kinase -
  GO004_RS11895 (GO004_11885) yczN 2255149..2255262 (+) 114 WP_032678937.1 YjcZ family sporulation protein -
  GO004_RS11900 (GO004_11890) yczM 2255344..2255433 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  GO004_RS11905 (GO004_11895) phrC 2255533..2255655 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  GO004_RS11910 (GO004_11900) rapC 2255639..2256787 (-) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  GO004_RS11915 (GO004_11905) yclK 2256950..2258371 (-) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  GO004_RS11920 (GO004_11910) yclJ 2258358..2259041 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=405801 GO004_RS11905 WP_003224994.1 2255533..2255655(-) (phrC) [Bacillus subtilis strain R31]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=405801 GO004_RS11905 WP_003224994.1 2255533..2255655(-) (phrC) [Bacillus subtilis strain R31]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment