Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   GFX43_RS19405 Genome accession   NZ_CP046448
Coordinates   3769861..3769983 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain ZD01     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3764861..3774983
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  GFX43_RS19375 (GFX43_019375) yclP 3764933..3765691 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  GFX43_RS19380 (GFX43_019380) yclO 3765685..3766632 (-) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  GFX43_RS19385 (GFX43_019385) ceuB 3766625..3767575 (-) 951 WP_015382768.1 petrobactin ABC transporter permease YclN Machinery gene
  GFX43_RS19390 (GFX43_019390) thrD 3767960..3769324 (+) 1365 WP_015382767.1 aspartate kinase -
  GFX43_RS19395 (GFX43_019395) yczN 3769477..3769590 (+) 114 WP_014478831.1 YjcZ family sporulation protein -
  GFX43_RS19400 (GFX43_019400) yczM 3769672..3769761 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  GFX43_RS19405 (GFX43_019405) phrC 3769861..3769983 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  GFX43_RS19410 (GFX43_019410) rapC 3769967..3771115 (-) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  GFX43_RS19415 (GFX43_019415) yclK 3771279..3772700 (-) 1422 WP_080030630.1 two-component system sensor histidine kinase YclK -
  GFX43_RS19420 (GFX43_019420) yclJ 3772687..3773370 (-) 684 WP_015482792.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=404431 GFX43_RS19405 WP_003224994.1 3769861..3769983(-) (phrC) [Bacillus subtilis strain ZD01]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=404431 GFX43_RS19405 WP_003224994.1 3769861..3769983(-) (phrC) [Bacillus subtilis strain ZD01]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment