Detailed information
Bioinformatically predicted
Overview
| Name | amiF | Type | Regulator |
| Locus tag | GKC13_RS10465 | Genome accession | NZ_CP046134 |
| Coordinates | 532581..532652 (+) | Length | 23 a.a. |
| NCBI ID | WP_340139154.1 | Uniprot ID | - |
| Organism | Streptococcus thermophilus strain MAG_rmk202_sterm | ||
| Function | internalize XIP (predicted from homology) Competence regulation |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| IScluster/Tn | 529079..534317 | 532581..532652 | within | 0 |
Gene organization within MGE regions
Location: 529079..534317
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| GKC13_RS02810 (GKC13_02820) | - | 529079..530431 (+) | 1353 | Protein_549 | IS3 family transposase | - |
| GKC13_RS02815 (GKC13_02825) | - | 530478..531683 (-) | 1206 | WP_011681420.1 | OFA family MFS transporter | - |
| GKC13_RS02820 (GKC13_02830) | - | 532199..532559 (+) | 361 | Protein_551 | TatD family hydrolase | - |
| GKC13_RS10465 | amiF | 532581..532652 (+) | 72 | WP_340139154.1 | hypothetical protein | Regulator |
| GKC13_RS10470 (GKC13_02840) | amiF | 532787..532957 (+) | 171 | WP_014608546.1 | hypothetical protein | Regulator |
| GKC13_RS02835 (GKC13_02845) | - | 532948..533132 (+) | 185 | Protein_554 | IS3 family transposase | - |
Sequence
Protein
Download Length: 23 a.a. Molecular weight: 2458.86 Da Isoelectric Point: 3.2604
>NTDB_id=401546 GKC13_RS10465 WP_340139154.1 532581..532652(+) (amiF) [Streptococcus thermophilus strain MAG_rmk202_sterm]
MASSLVMQPDLIITDEPISALDV
MASSLVMQPDLIITDEPISALDV
Nucleotide
Download Length: 72 bp
>NTDB_id=401546 GKC13_RS10465 WP_340139154.1 532581..532652(+) (amiF) [Streptococcus thermophilus strain MAG_rmk202_sterm]
ATTGCGAGTTCTTTGGTCATGCAGCCTGATTTGATTATCACTGATGAACCAATCTCAGCCCTTGACGTGTAG
ATTGCGAGTTCTTTGGTCATGCAGCCTGATTTGATTATCACTGATGAACCAATCTCAGCCCTTGACGTGTAG
Domains
No domain identified.
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| amiF | Streptococcus thermophilus LMD-9 |
82.609 |
100 |
0.826 |
| amiF | Streptococcus thermophilus LMG 18311 |
82.609 |
100 |
0.826 |
| amiF | Streptococcus salivarius strain HSISS4 |
82.609 |
100 |
0.826 |
| amiE | Streptococcus thermophilus LMG 18311 |
52.174 |
100 |
0.522 |
| amiE | Streptococcus thermophilus LMD-9 |
52.174 |
100 |
0.522 |
| amiE | Streptococcus salivarius strain HSISS4 |
52.174 |
100 |
0.522 |
| oppD | Streptococcus mutans UA159 |
43.478 |
100 |
0.435 |
| rcrP | Streptococcus mutans UA159 |
40.909 |
95.652 |
0.391 |