Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   GII78_RS02150 Genome accession   NZ_CP045824
Coordinates   428224..428346 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain MB8_B10     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 423224..433346
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  GII78_RS02135 (GII78_02135) yclJ 424838..425521 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  GII78_RS02140 (GII78_02140) yclK 425508..426929 (+) 1422 WP_113713032.1 two-component system sensor histidine kinase YclK -
  GII78_RS02145 (GII78_02145) rapC 427092..428240 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  GII78_RS02150 (GII78_02150) phrC 428224..428346 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  GII78_RS02155 (GII78_02155) yczM 428446..428535 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  GII78_RS02160 (GII78_02160) yczN 428617..428730 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  GII78_RS02165 (GII78_02165) thrD 428884..430248 (-) 1365 WP_113713033.1 aspartate kinase -
  GII78_RS02170 (GII78_02170) ceuB 430633..431583 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  GII78_RS02175 (GII78_02175) yclO 431576..432523 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  GII78_RS02180 (GII78_02180) yclP 432517..433275 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=398194 GII78_RS02150 WP_003224994.1 428224..428346(+) (phrC) [Bacillus subtilis strain MB8_B10]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=398194 GII78_RS02150 WP_003224994.1 428224..428346(+) (phrC) [Bacillus subtilis strain MB8_B10]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment