Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   GII86_RS02370 Genome accession   NZ_CP045816
Coordinates   459268..459390 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain P5_B2     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 454268..464390
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  GII86_RS02355 (GII86_02355) yclJ 455882..456565 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  GII86_RS02360 (GII86_02360) yclK 456552..457973 (+) 1422 WP_153952928.1 two-component system sensor histidine kinase YclK -
  GII86_RS02365 (GII86_02365) rapC 458136..459284 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  GII86_RS02370 (GII86_02370) phrC 459268..459390 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  GII86_RS02375 (GII86_02375) yczM 459490..459579 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  GII86_RS02380 (GII86_02380) yczN 459661..459774 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  GII86_RS02385 (GII86_02385) thrD 459927..461291 (-) 1365 WP_032726529.1 aspartate kinase -
  GII86_RS02390 (GII86_02390) ceuB 461676..462626 (+) 951 WP_015382768.1 petrobactin ABC transporter permease YclN Machinery gene
  GII86_RS02395 (GII86_02395) yclO 462619..463566 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  GII86_RS02400 (GII86_02400) yclP 463560..464318 (+) 759 WP_046160055.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=397632 GII86_RS02370 WP_003224994.1 459268..459390(+) (phrC) [Bacillus subtilis strain P5_B2]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=397632 GII86_RS02370 WP_003224994.1 459268..459390(+) (phrC) [Bacillus subtilis strain P5_B2]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment