Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   GCU76_RS02190 Genome accession   NZ_CP045425
Coordinates   433767..433889 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain JAAA     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 428767..438889
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  GCU76_RS02175 yclJ 430380..431063 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  GCU76_RS02180 yclK 431050..432471 (+) 1422 WP_080317125.1 two-component system sensor histidine kinase YclK -
  GCU76_RS02185 rapC 432635..433783 (+) 1149 WP_152425352.1 response regulator aspartate phosphatase RapC Regulator
  GCU76_RS02190 phrC 433767..433889 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  GCU76_RS02195 yczM 433989..434078 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  GCU76_RS02200 yczN 434160..434273 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  GCU76_RS02205 thrD 434427..435791 (-) 1365 WP_041340152.1 aspartate kinase -
  GCU76_RS02210 ceuB 436176..437126 (+) 951 WP_017696153.1 petrobactin ABC transporter permease YclN Machinery gene
  GCU76_RS02215 yclO 437119..438066 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  GCU76_RS02220 yclP 438060..438818 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=393960 GCU76_RS02190 WP_003224994.1 433767..433889(+) (phrC) [Bacillus subtilis strain JAAA]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=393960 GCU76_RS02190 WP_003224994.1 433767..433889(+) (phrC) [Bacillus subtilis strain JAAA]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment