Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   F8M43_RS02165 Genome accession   NZ_CP044498
Coordinates   428171..428293 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain ms-2     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 423171..433293
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  F8M43_RS02150 yclJ 424785..425468 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  F8M43_RS02155 yclK 425455..426876 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  F8M43_RS02160 rapC 427039..428187 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  F8M43_RS02165 phrC 428171..428293 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  F8M43_RS02170 yczM 428393..428482 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  F8M43_RS02175 yczN 428564..428677 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  F8M43_RS02180 thrD 428830..430194 (-) 1365 WP_029726569.1 aspartate kinase -
  F8M43_RS02185 ceuB 430579..431529 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  F8M43_RS02190 yclO 431522..432469 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  F8M43_RS02195 yclP 432463..433221 (+) 759 WP_151433381.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=390532 F8M43_RS02165 WP_003224994.1 428171..428293(+) (phrC) [Bacillus subtilis strain ms-2]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=390532 F8M43_RS02165 WP_003224994.1 428171..428293(+) (phrC) [Bacillus subtilis strain ms-2]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment