Detailed information NTG0347876

Bioinformatically predicted

Overview

• Name: pilA
• Type: Machinery gene
• Locus tag: Pan97_RS26620
• Genome accession: NZ_CP036289
• Coordinates: 1379846..1379971 (+)
• Length: 41 a.a.
• NCBI ID: WP_144971123.1
• Uniprot ID: A0A518C4H5
• Organism: Bremerella volcania strain Pan97
• Function: type IV pilus biogenesis and function (predicted from homology) DNA binding and uptake

Genomic Context

Location: 1374846..1384971

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
Pan97_RS05465 (Pan97_11270)	-	1374935..1375597 (+)	663	WP_144971118.1	hypothetical protein	-
Pan97_RS05470 (Pan97_11280)	-	1375653..1375931 (-)	279	WP_165698624.1	DUF4404 family protein	-
Pan97_RS05475 (Pan97_11290)	-	1376073..1377251 (-)	1179	WP_144971120.1	PDZ domain-containing protein	-
Pan97_RS05480 (Pan97_11300)	-	1377375..1378442 (-)	1068	WP_144971121.1	S1C family serine protease	-
Pan97_RS05485 (Pan97_11310)	-	1378730..1379599 (+)	870	WP_144971122.1	SDR family oxidoreductase	-
Pan97_RS26620 (Pan97_11320)	pilA	1379846..1379971 (+)	126	WP_144971123.1	type II secretion system protein	Machinery gene
Pan97_RS05495 (Pan97_11330)	-	1380005..1380823 (+)	819	WP_165698625.1	DUF1559 domain-containing protein	-
Pan97_RS05500 (Pan97_11340)	-	1380932..1381402 (+)	471	WP_144971125.1	carboxypeptidase-like regulatory domain-containing protein	-
Pan97_RS05505 (Pan97_11350)	-	1381415..1382293 (-)	879	WP_144971126.1	hypothetical protein	-
Pan97_RS05510 (Pan97_11360)	-	1382456..1383889 (+)	1434	WP_144971127.1	sulfatase	-

Sequence

Protein

• Length: 41 a.a.
• Molecular weight: 4375.29 Da
• Isoelectric Point: 12.0228

>NTDB_id=347876 Pan97_RS26620 WP_144971123.1 1379846..1379971(+) (pilA) [Bremerella volcania strain Pan97]
MRTNARSSGFTLVELLVVIAIIGVLIALLLPAVQQAREAAR

Nucleotide

• Length: 126 bp

>NTDB_id=347876 Pan97_RS26620 WP_144971123.1 1379846..1379971(+) (pilA) [Bremerella volcania strain Pan97]
ATGCGCACCAACGCCAGATCGAGTGGCTTCACACTCGTCGAACTTCTTGTGGTCATTGCAATCATCGGCGTCTTGATCGC
GCTTCTTTTGCCTGCGGTTCAACAGGCACGCGAGGCGGCCCGTTGA

Domains

Predicted by InterproScan.

• Prokaryotic N-terminal methylation motif (N_methyl) (5-30)

3D structure

• AlphaFold DB: A0A518C4H5

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
pilA/pilA1	Synechocystis sp. PCC 6803	60	85.366	0.512
pilA	Vibrio campbellii strain DS40M4	50	100	0.512
pilV	Deinococcus radiodurans R1 = ATCC 13939 = DSM 20539	57.143	85.366	0.488
pilE	Neisseria elongata subsp. glycolytica ATCC 29315	63.333	73.171	0.463
pilE	Neisseria gonorrhoeae strain FA1090	58.065	75.61	0.439
pilE	Neisseria gonorrhoeae MS11	58.065	75.61	0.439
pilA	Vibrio parahaemolyticus RIMD 2210633	56.667	73.171	0.415
pilA/pilAI	Pseudomonas stutzeri DSM 10701	65.385	63.415	0.415
comYC	Streptococcus gordonii str. Challis substr. CH1	50	82.927	0.415
xcpW	Acinetobacter baumannii D1279779	73.913	56.098	0.415
comGC/cglC	Streptococcus pneumoniae Rx1	48.571	85.366	0.415
comGC/cglC	Streptococcus pneumoniae D39	48.571	85.366	0.415
comGC/cglC	Streptococcus pneumoniae TIGR4	48.571	85.366	0.415
comGC/cglC	Streptococcus pneumoniae R6	48.571	85.366	0.415
fimT	Acinetobacter baylyi ADP1	48.571	85.366	0.415
comYC	Streptococcus suis isolate S10	47.059	82.927	0.39
pilA	Vibrio cholerae O1 biovar El Tor strain E7946	51.613	75.61	0.39
pilA	Vibrio cholerae C6706	51.613	75.61	0.39
pilA	Vibrio cholerae strain A1552	51.613	75.61	0.39
pilV	Deinococcus radiodurans R1 = ATCC 13939 = DSM 20539	72.727	53.659	0.39
pilA/pilAII	Pseudomonas stutzeri DSM 10701	61.538	63.415	0.39
pilA/pilA3	Thermus thermophilus HB27	45.455	80.488	0.366
pilA	Ralstonia pseudosolanacearum GMI1000	55.556	65.854	0.366
comF	Acinetobacter baylyi ADP1	51.724	70.732	0.366