Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   EQZ01_RS02370 Genome accession   NZ_CP035231
Coordinates   457523..457645 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM103571     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 452523..462645
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  EQZ01_RS02355 (EQZ01_02355) yclJ 454137..454820 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  EQZ01_RS02360 (EQZ01_02360) yclK 454807..456228 (+) 1422 WP_106074061.1 two-component system sensor histidine kinase YclK -
  EQZ01_RS02365 (EQZ01_02365) rapC 456391..457539 (+) 1149 WP_024571686.1 response regulator aspartate phosphatase RapC Regulator
  EQZ01_RS02370 (EQZ01_02370) phrC 457523..457645 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  EQZ01_RS02375 (EQZ01_02375) yczM 457743..457832 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  EQZ01_RS02380 (EQZ01_02380) yczN 457914..458027 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  EQZ01_RS02385 (EQZ01_02385) thrD 458181..459545 (-) 1365 WP_106074063.1 aspartate kinase -
  EQZ01_RS02390 (EQZ01_02390) ceuB 459930..460880 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  EQZ01_RS02395 (EQZ01_02395) yclO 460873..461820 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  EQZ01_RS02400 (EQZ01_02400) yclP 461814..462572 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=336427 EQZ01_RS02370 WP_003224994.1 457523..457645(+) (phrC) [Bacillus subtilis strain SRCM103571]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=336427 EQZ01_RS02370 WP_003224994.1 457523..457645(+) (phrC) [Bacillus subtilis strain SRCM103571]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGCATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment