Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   EQI48_RS02175 Genome accession   NZ_CP035164
Coordinates   428193..428315 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM104005     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 423193..433315
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  EQI48_RS02160 (EQI48_02160) yclJ 424807..425490 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  EQI48_RS02165 (EQI48_02165) yclK 425477..426898 (+) 1422 WP_088325304.1 two-component system sensor histidine kinase YclK -
  EQI48_RS02170 (EQI48_02170) rapC 427061..428209 (+) 1149 WP_024571686.1 response regulator aspartate phosphatase RapC Regulator
  EQI48_RS02175 (EQI48_02175) phrC 428193..428315 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  EQI48_RS02180 (EQI48_02180) yczM 428415..428504 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  EQI48_RS02185 (EQI48_02185) yczN 428586..428699 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  EQI48_RS02190 (EQI48_02190) thrD 428853..430217 (-) 1365 WP_033883679.1 aspartate kinase -
  EQI48_RS02195 (EQI48_02195) ceuB 430602..431552 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  EQI48_RS02200 (EQI48_02200) yclO 431545..432492 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  EQI48_RS02205 (EQI48_02205) yclP 432486..433244 (+) 759 WP_086343457.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=335167 EQI48_RS02175 WP_003224994.1 428193..428315(+) (phrC) [Bacillus subtilis strain SRCM104005]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=335167 EQI48_RS02175 WP_003224994.1 428193..428315(+) (phrC) [Bacillus subtilis strain SRCM104005]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment