Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   EO946_RS02190 Genome accession   NZ_CP034943
Coordinates   427407..427529 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus spizizenii ATCC 6633 = JCM 2499 strain ATCC 6633     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 422407..432529
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  EO946_RS02175 (EO946_02175) yclJ 424022..424705 (+) 684 WP_003224983.1 two-component system response regulator YclJ -
  EO946_RS02180 (EO946_02180) yclK 424692..426113 (+) 1422 WP_079996289.1 two-component system sensor histidine kinase YclK -
  EO946_RS02185 (EO946_02185) rapC 426275..427423 (+) 1149 WP_003224987.1 response regulator aspartate phosphatase RapC Regulator
  EO946_RS02190 (EO946_02190) phrC 427407..427529 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  EO946_RS02195 (EO946_02195) - 427628..427735 (-) 108 WP_003224996.1 YjcZ family sporulation protein -
  EO946_RS02200 (EO946_02200) - 427884..429248 (-) 1365 WP_003224998.1 aspartate kinase -
  EO946_RS02205 (EO946_02205) ceuB 429633..430583 (+) 951 WP_003225000.1 petrobactin ABC transporter permease YclN Machinery gene
  EO946_RS02210 (EO946_02210) yclO 430576..431523 (+) 948 WP_003225003.1 petrobactin ABC transporter permease YclO -
  EO946_RS02215 (EO946_02215) yclP 431517..432275 (+) 759 WP_003225005.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=333553 EO946_RS02190 WP_003224994.1 427407..427529(+) (phrC) [Bacillus spizizenii ATCC 6633 = JCM 2499 strain ATCC 6633]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=333553 EO946_RS02190 WP_003224994.1 427407..427529(+) (phrC) [Bacillus spizizenii ATCC 6633 = JCM 2499 strain ATCC 6633]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAACGC
GGAAGCACTCGACTTTCATGTGACGGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment