Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   D9C20_RS12030 Genome accession   NZ_CP032867
Coordinates   2272186..2272308 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain N4-2     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 2267186..2277308
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  D9C20_RS12015 (D9C20_12015) yclJ 2268800..2269483 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  D9C20_RS12020 (D9C20_12020) yclK 2269470..2270891 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  D9C20_RS12025 (D9C20_12025) rapC 2271054..2272202 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  D9C20_RS12030 (D9C20_12030) phrC 2272186..2272308 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  D9C20_RS12035 (D9C20_12035) yczM 2272407..2272496 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  D9C20_RS12040 (D9C20_12040) yczN 2272578..2272691 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  D9C20_RS12045 (D9C20_12045) thrD 2272844..2274208 (-) 1365 WP_014478832.1 aspartate kinase -
  D9C20_RS12050 (D9C20_12050) ceuB 2274599..2275549 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  D9C20_RS12055 (D9C20_12055) yclO 2275542..2276489 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  D9C20_RS12060 (D9C20_12060) yclP 2276483..2277241 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=319817 D9C20_RS12030 WP_003224994.1 2272186..2272308(+) (phrC) [Bacillus subtilis subsp. subtilis strain N4-2]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=319817 D9C20_RS12030 WP_003224994.1 2272186..2272308(+) (phrC) [Bacillus subtilis subsp. subtilis strain N4-2]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment