Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   D9C14_RS10310 Genome accession   NZ_CP032860
Coordinates   1984348..1984470 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain SSJ-1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 1979348..1989470
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  D9C14_RS10295 (D9C14_10295) yclJ 1980962..1981645 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  D9C14_RS10300 (D9C14_10300) yclK 1981632..1983053 (+) 1422 WP_106074061.1 two-component system sensor histidine kinase YclK -
  D9C14_RS10305 (D9C14_10305) rapC 1983216..1984364 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  D9C14_RS10310 (D9C14_10310) phrC 1984348..1984470 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  D9C14_RS10315 (D9C14_10315) yczM 1984570..1984659 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  D9C14_RS10320 (D9C14_10320) yczN 1984741..1984854 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  D9C14_RS10325 (D9C14_10325) thrD 1985007..1986371 (-) 1365 WP_029726569.1 aspartate kinase -
  D9C14_RS10330 (D9C14_10330) ceuB 1986756..1987706 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  D9C14_RS10335 (D9C14_10335) yclO 1987699..1988646 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  D9C14_RS10340 (D9C14_10340) yclP 1988640..1989398 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=319486 D9C14_RS10310 WP_003224994.1 1984348..1984470(+) (phrC) [Bacillus subtilis subsp. subtilis strain SSJ-1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=319486 D9C14_RS10310 WP_003224994.1 1984348..1984470(+) (phrC) [Bacillus subtilis subsp. subtilis strain SSJ-1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment