Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   D9C11_RS13440 Genome accession   NZ_CP032855
Coordinates   2515736..2515858 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain PJ-7     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 2510736..2520858
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  D9C11_RS13425 (D9C11_13425) yclJ 2512349..2513032 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  D9C11_RS13430 (D9C11_13430) yclK 2513019..2514440 (+) 1422 WP_072557076.1 two-component system sensor histidine kinase YclK -
  D9C11_RS13435 (D9C11_13435) rapC 2514604..2515752 (+) 1149 WP_015252823.1 response regulator aspartate phosphatase RapC Regulator
  D9C11_RS13440 (D9C11_13440) phrC 2515736..2515858 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  D9C11_RS13445 (D9C11_13445) yczM 2515958..2516047 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  D9C11_RS13450 (D9C11_13450) yczN 2516129..2516242 (-) 114 WP_032728921.1 YjcZ family sporulation protein -
  D9C11_RS13455 (D9C11_13455) thrD 2516395..2517759 (-) 1365 WP_041340152.1 aspartate kinase -
  D9C11_RS13460 (D9C11_13460) ceuB 2518156..2519106 (+) 951 WP_087960839.1 petrobactin ABC transporter permease YclN Machinery gene
  D9C11_RS13465 (D9C11_13465) yclO 2519099..2520046 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  D9C11_RS13470 (D9C11_13470) yclP 2520040..2520801 (+) 762 WP_121591431.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=319346 D9C11_RS13440 WP_003224994.1 2515736..2515858(+) (phrC) [Bacillus subtilis subsp. subtilis strain PJ-7]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=319346 D9C11_RS13440 WP_003224994.1 2515736..2515858(+) (phrC) [Bacillus subtilis subsp. subtilis strain PJ-7]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment