Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   D9C10_RS22160 Genome accession   NZ_CP032853
Coordinates   4107412..4107534 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain MH-1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 4102412..4112534
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  D9C10_RS22145 (D9C10_22145) yclJ 4104026..4104709 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  D9C10_RS22150 (D9C10_22150) yclK 4104696..4106117 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  D9C10_RS22155 (D9C10_22155) rapC 4106280..4107428 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  D9C10_RS22160 (D9C10_22160) phrC 4107412..4107534 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  D9C10_RS22165 (D9C10_22165) yczM 4107633..4107722 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  D9C10_RS22170 (D9C10_22170) yczN 4107804..4107917 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  D9C10_RS22175 (D9C10_22175) thrD 4108070..4109434 (-) 1365 WP_021481755.1 aspartate kinase -
  D9C10_RS22180 (D9C10_22180) ceuB 4109825..4110775 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  D9C10_RS22185 (D9C10_22185) yclO 4110768..4111715 (+) 948 WP_121549314.1 petrobactin ABC transporter permease YclO -
  D9C10_RS22190 (D9C10_22190) yclP 4111709..4112467 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=319289 D9C10_RS22160 WP_003224994.1 4107412..4107534(+) (phrC) [Bacillus subtilis subsp. subtilis strain MH-1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=319289 D9C10_RS22160 WP_003224994.1 4107412..4107534(+) (phrC) [Bacillus subtilis subsp. subtilis strain MH-1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment