Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   D3Z87_RS02130 Genome accession   NZ_CP032310
Coordinates   422698..422820 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain WB800N     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 417698..427820
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  D3Z87_RS02115 (D3Z87_02105) yclJ 419312..419995 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  D3Z87_RS02120 (D3Z87_02110) yclK 419982..421403 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  D3Z87_RS02125 (D3Z87_02115) rapC 421566..422714 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  D3Z87_RS02130 (D3Z87_02120) phrC 422698..422820 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  D3Z87_RS02135 (D3Z87_02125) yczM 422920..423009 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  D3Z87_RS02140 (D3Z87_02130) yczN 423091..423204 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  D3Z87_RS02145 (D3Z87_02135) thrD 423358..424722 (-) 1365 WP_009966541.1 aspartate kinase -
  D3Z87_RS02150 (D3Z87_02140) ceuB 425107..426057 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  D3Z87_RS02155 (D3Z87_02145) yclO 426050..426997 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  D3Z87_RS02160 (D3Z87_02150) yclP 426991..427749 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=314861 D3Z87_RS02130 WP_003224994.1 422698..422820(+) (phrC) [Bacillus subtilis strain WB800N]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=314861 D3Z87_RS02130 WP_003224994.1 422698..422820(+) (phrC) [Bacillus subtilis strain WB800N]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment