Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   D0808_RS04850 Genome accession   NZ_CP031783
Coordinates   957251..957373 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain MENO2 voucher National Research Centre     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 952251..962373
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  D0808_RS04835 (D0808_04885) yclJ 953864..954547 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  D0808_RS04840 (D0808_04890) yclK 954534..955955 (+) 1422 WP_153255668.1 two-component system sensor histidine kinase YclK -
  D0808_RS04845 (D0808_04895) rapC 956119..957267 (+) 1149 WP_024571686.1 response regulator aspartate phosphatase RapC Regulator
  D0808_RS04850 (D0808_04900) phrC 957251..957373 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  D0808_RS04855 (D0808_04905) yczM 957472..957561 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  D0808_RS04860 (D0808_04910) yczN 957643..957756 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  D0808_RS04865 (D0808_04915) thrD 957909..959273 (-) 1365 WP_153255669.1 aspartate kinase -
  D0808_RS04870 (D0808_04920) ceuB 959658..960608 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  D0808_RS04875 (D0808_04925) yclO 960601..961548 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  D0808_RS04880 (D0808_04930) yclP 961542..962300 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=311282 D0808_RS04850 WP_003224994.1 957251..957373(+) (phrC) [Bacillus subtilis strain MENO2 voucher National Research Centre]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=311282 D0808_RS04850 WP_003224994.1 957251..957373(+) (phrC) [Bacillus subtilis strain MENO2 voucher National Research Centre]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment