Detailed information    

insolico Bioinformatically predicted

Overview


Name   comGE   Type   Machinery gene
Locus tag   L3107_RS11425 Genome accession   NZ_CP031538
Coordinates   2203653..2203949 (-) Length   98 a.a.
NCBI ID   WP_021164977.1    Uniprot ID   A0A2Z5Z499
Organism   Lactococcus cremoris strain 3107     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context


Location: 2198653..2208949
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  L3107_RS11395 (L3107_2226) - 2199847..2200656 (-) 810 WP_011677177.1 metal ABC transporter permease -
  L3107_RS11400 (L3107_2227) - 2200649..2201386 (-) 738 WP_011677178.1 metal ABC transporter ATP-binding protein -
  L3107_RS11405 (L3107_2228) - 2201565..2202407 (-) 843 WP_021164979.1 zinc ABC transporter substrate-binding protein -
  L3107_RS11410 (L3107_2229) - 2202404..2202841 (-) 438 WP_011677180.1 zinc-dependent MarR family transcriptional regulator -
  L3107_RS11415 comGG 2202921..2203148 (-) 228 WP_228764408.1 competence protein ComGG Machinery gene
  L3107_RS11420 (L3107_2231) comGF 2203244..2203690 (-) 447 WP_011836043.1 competence type IV pilus minor pilin ComGF Machinery gene
  L3107_RS11425 (L3107_2232) comGE 2203653..2203949 (-) 297 WP_021164977.1 competence type IV pilus minor pilin ComGE Machinery gene
  L3107_RS13845 (L3107_2233) comGD 2203921..2204109 (-) 189 WP_014573336.1 hypothetical protein Machinery gene
  L3107_RS11435 (L3107_2234) comGC 2204311..2204661 (-) 351 WP_050574187.1 competence type IV pilus major pilin ComGC Machinery gene
  L3107_RS11440 (L3107_2235) comGB 2204706..2205731 (-) 1026 WP_050574185.1 competence type IV pilus assembly protein ComGB Machinery gene
  L3107_RS11445 (L3107_2236) comGA 2205631..2206611 (-) 981 WP_021164974.1 competence type IV pilus ATPase ComGA Machinery gene

Sequence


Protein


Download         Length: 98 a.a.        Molecular weight: 10958.72 Da        Isoelectric Point: 5.0658

>NTDB_id=307375 L3107_RS11425 WP_021164977.1 2203653..2203949(-) (comGE) [Lactococcus cremoris strain 3107]
MENIKRKSIKGCILLESLISMALLSFLVTFLLSALTNSRQQEVQENQQIESLNVAQMAIESQLMELSLNGSVIKIRQDST
ATIISDHGKEILRLEAQN

Nucleotide


Download         Length: 297 bp        

>NTDB_id=307375 L3107_RS11425 WP_021164977.1 2203653..2203949(-) (comGE) [Lactococcus cremoris strain 3107]
GTGGAAAATATAAAAAGAAAATCAATTAAGGGATGTATACTTCTTGAGAGCCTAATTAGTATGGCATTATTGAGCTTTTT
GGTCACTTTTCTCTTAAGTGCTCTTACTAATTCTCGTCAGCAAGAGGTACAAGAAAATCAACAAATTGAGTCCTTAAATG
TAGCTCAGATGGCAATAGAAAGTCAGCTGATGGAACTATCGTTAAATGGTTCTGTTATAAAAATAAGACAAGATTCGACT
GCAACCATTATTAGTGACCATGGAAAGGAAATTTTGCGACTTGAAGCTCAAAATTAG


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

95.918

100

0.959


Multiple sequence alignment