Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   ETA10_RS02190 Genome accession   NZ_CP035397
Coordinates   427072..427194 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM103773     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 422072..432194
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ETA10_RS02175 (ETA10_02175) yclJ 423686..424369 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ETA10_RS02180 (ETA10_02180) yclK 424356..425777 (+) 1422 WP_080348068.1 two-component system sensor histidine kinase YclK -
  ETA10_RS02185 (ETA10_02185) rapC 425940..427088 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  ETA10_RS02190 (ETA10_02190) phrC 427072..427194 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ETA10_RS02195 (ETA10_02195) yczM 427294..427383 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ETA10_RS02200 (ETA10_02200) yczN 427465..427578 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  ETA10_RS02205 (ETA10_02205) thrD 427731..429095 (-) 1365 WP_129110440.1 aspartate kinase -
  ETA10_RS02210 (ETA10_02210) ceuB 429480..430430 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ETA10_RS02215 (ETA10_02215) yclO 430423..431370 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  ETA10_RS02220 (ETA10_02220) yclP 431364..432122 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=299133 ETA10_RS02190 WP_003224994.1 427072..427194(+) (phrC) [Bacillus subtilis strain SRCM103773]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=299133 ETA10_RS02190 WP_003224994.1 427072..427194(+) (phrC) [Bacillus subtilis strain SRCM103773]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1