Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   DKG76_RS02155 Genome accession   NZ_CP029465
Coordinates   425007..425129 (+) Length   40 a.a.
NCBI ID   WP_003240188.1    Uniprot ID   A0A9Q4EQJ2
Organism   Bacillus inaquosorum strain KCTC 13429     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 420007..430129
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  DKG76_RS02140 (DKG76_02140) yclJ 421627..422310 (+) 684 WP_003240180.1 two-component system response regulator YclJ -
  DKG76_RS02145 (DKG76_02145) - 422297..423712 (+) 1416 WP_080030875.1 HAMP domain-containing sensor histidine kinase -
  DKG76_RS02150 (DKG76_02150) rapC 423875..425023 (+) 1149 WP_003240186.1 response regulator aspartate phosphatase RapC Regulator
  DKG76_RS02155 (DKG76_02155) phrC 425007..425129 (+) 123 WP_003240188.1 phosphatase RapC inhibitor PhrC Regulator
  DKG76_RS02160 (DKG76_02160) - 425225..425332 (-) 108 WP_019257466.1 YjcZ family sporulation protein -
  DKG76_RS02165 (DKG76_02165) - 425474..426847 (-) 1374 WP_003240191.1 aspartate kinase -
  DKG76_RS02170 (DKG76_02170) ceuB 427231..428181 (+) 951 WP_003240192.1 petrobactin ABC transporter permease YclN Machinery gene
  DKG76_RS02175 (DKG76_02175) yclO 428174..429121 (+) 948 WP_003240194.1 petrobactin ABC transporter permease YclO -
  DKG76_RS02180 (DKG76_02180) yclP 429115..429873 (+) 759 WP_003240196.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4242.04 Da        Isoelectric Point: 8.0285

>NTDB_id=292705 DKG76_RS02155 WP_003240188.1 425007..425129(+) (phrC) [Bacillus inaquosorum strain KCTC 13429]
MKLKSKLFVICLAAAAIFTVAGVSANAESLDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=292705 DKG76_RS02155 WP_003240188.1 425007..425129(+) (phrC) [Bacillus inaquosorum strain KCTC 13429]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGTGGCTGGCGTTTCTGCTAACGC
CGAATCACTCGACTTTCATGTAACGGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

95

100

0.95

Multiple sequence alignment