Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   DIC78_RS08065 Genome accession   NZ_CP029364
Coordinates   1581203..1581325 (-) Length   40 a.a.
NCBI ID   WP_010333023.1    Uniprot ID   Q6B9X2
Organism   Bacillus halotolerans strain ZB201702     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 1576203..1586325
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  DIC78_RS08035 (DIC78_08050) yclP 1576204..1576962 (-) 759 WP_106021019.1 petrobactin ABC transporter ATP-binding protein YclP -
  DIC78_RS08040 (DIC78_08055) yclO 1576956..1577903 (-) 948 WP_127695982.1 petrobactin ABC transporter permease YclO -
  DIC78_RS08045 (DIC78_08060) ceuB 1577896..1578846 (-) 951 WP_010333025.1 petrobactin ABC transporter permease YclN Machinery gene
  DIC78_RS08050 (DIC78_08065) - 1579232..1580596 (+) 1365 WP_095714086.1 aspartate kinase -
  DIC78_RS08055 (DIC78_08070) - 1580749..1580859 (+) 111 WP_106021023.1 YjcZ family sporulation protein -
  DIC78_RS08060 (DIC78_08075) - 1581006..1581098 (+) 93 WP_024120214.1 YjcZ family sporulation protein -
  DIC78_RS08065 (DIC78_08080) phrC 1581203..1581325 (-) 123 WP_010333023.1 PhrC/PhrF family phosphatase-inhibitory pheromone Regulator
  DIC78_RS08070 (DIC78_08085) rapC 1581309..1582457 (-) 1149 WP_024120212.1 response regulator aspartate phosphatase RapC Regulator
  DIC78_RS08075 (DIC78_08090) - 1582626..1584050 (-) 1425 WP_101860980.1 sensor histidine kinase -
  DIC78_RS08080 (DIC78_08095) - 1584037..1584720 (-) 684 WP_127695984.1 response regulator transcription factor -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4208.97 Da        Isoelectric Point: 8.0579

>NTDB_id=291964 DIC78_RS08065 WP_010333023.1 1581203..1581325(-) (phrC) [Bacillus halotolerans strain ZB201702]
MKLKSKLFVICLAAAAVFTAVGVSAHAEASDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=291964 DIC78_RS08065 WP_010333023.1 1581203..1581325(-) (phrC) [Bacillus halotolerans strain ZB201702]
ATGAAATTGAAATCTAAGTTATTTGTTATTTGTTTGGCTGCAGCAGCTGTTTTTACAGCGGTTGGCGTCTCTGCACATGC
TGAAGCATCCGACTTTCATGTCACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB Q6B9X2

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

90

100

0.9

Multiple sequence alignment