Detailed information    

insolico Bioinformatically predicted

Overview


Name   comGE   Type   Machinery gene
Locus tag   LL267_RS11355 Genome accession   NZ_CP032058
Coordinates   2217620..2217916 (-) Length   98 a.a.
NCBI ID   WP_010906316.1    Uniprot ID   Q9CDU2
Organism   Lactococcus lactis subsp. lactis strain 267     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context


Location: 2212620..2222916
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LL267_RS11320 (LL267_2174) - 2212733..2213542 (-) 810 WP_014570791.1 metal ABC transporter permease -
  LL267_RS11325 (LL267_2175) - 2213535..2214272 (-) 738 WP_058221575.1 metal ABC transporter ATP-binding protein -
  LL267_RS11330 (LL267_2176) - 2214449..2215291 (-) 843 WP_003129990.1 metal ABC transporter substrate-binding protein -
  LL267_RS11335 (LL267_2177) - 2215288..2215725 (-) 438 WP_003129992.1 zinc-dependent MarR family transcriptional regulator -
  LL267_RS11340 (LL267_2178) - 2215932..2216879 (+) 948 WP_003130410.1 IS30 family transposase -
  LL267_RS11345 (LL267_2179) comGG 2216853..2217179 (-) 327 WP_058221568.1 competence type IV pilus minor pilin ComGG Machinery gene
  LL267_RS11350 (LL267_2180) comGF 2217229..2217657 (-) 429 Protein_2210 competence type IV pilus minor pilin ComGF -
  LL267_RS11355 (LL267_2181) comGE 2217620..2217916 (-) 297 WP_010906316.1 competence type IV pilus minor pilin ComGE Machinery gene
  LL267_RS11360 (LL267_2182) comGD 2217888..2218319 (-) 432 WP_080585155.1 competence type IV pilus minor pilin ComGD Machinery gene
  LL267_RS11365 (LL267_2183) comGC 2218279..2218548 (-) 270 WP_003129998.1 competence type IV pilus major pilin ComGC Machinery gene
  LL267_RS11370 (LL267_2184) - 2218675..2219367 (-) 693 WP_152994386.1 hypothetical protein -
  LL267_RS11375 (LL267_2185) - 2219609..2220388 (-) 780 WP_082225220.1 peptidoglycan amidohydrolase family protein -
  LL267_RS11380 (LL267_2186) - 2220388..2220687 (-) 300 WP_031559226.1 phage holin -
  LL267_RS11385 (LL267_2187) - 2220700..2221050 (-) 351 WP_014570798.1 hypothetical protein -
  LL267_RS11390 (LL267_2188) - 2221063..2221299 (-) 237 WP_082225257.1 hypothetical protein -

Sequence


Protein


Download         Length: 98 a.a.        Molecular weight: 11076.95 Da        Isoelectric Point: 6.4684

>NTDB_id=274117 LL267_RS11355 WP_010906316.1 2217620..2217916(-) (comGE) [Lactococcus lactis subsp. lactis strain 267]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=274117 LL267_RS11355 WP_010906316.1 2217620..2217916(-) (comGE) [Lactococcus lactis subsp. lactis strain 267]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB Q9CDU2

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

68.041

98.98

0.673