Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   LL223_RS11640 Genome accession   NZ_CP031926
Coordinates   2260419..2260715 (-) Length   98 a.a.
NCBI ID   WP_010906316.1    Uniprot ID   Q9CDU2
Organism   Lactococcus lactis subsp. lactis strain 223     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 2255419..2265715
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LL223_RS11605 (LL223_2221) - 2255709..2256575 (+) 867 WP_010906309.1 RluA family pseudouridine synthase -
  LL223_RS11610 (LL223_2222) - 2256614..2257423 (-) 810 WP_010906310.1 metal ABC transporter permease -
  LL223_RS11615 (LL223_2223) - 2257416..2258153 (-) 738 WP_010906311.1 metal ABC transporter ATP-binding protein -
  LL223_RS11620 (LL223_2224) - 2258330..2259172 (-) 843 WP_010906312.1 metal ABC transporter substrate-binding protein -
  LL223_RS11625 (LL223_2225) - 2259169..2259606 (-) 438 WP_010906313.1 zinc-dependent MarR family transcriptional regulator -
  LL223_RS11630 (LL223_2226) comGG 2259687..2259971 (-) 285 WP_010906314.1 competence type IV pilus minor pilin ComGG Machinery gene
  LL223_RS11635 (LL223_2227) comGF 2260010..2260456 (-) 447 WP_031296844.1 competence type IV pilus minor pilin ComGF Machinery gene
  LL223_RS11640 (LL223_2228) comGE 2260419..2260715 (-) 297 WP_010906316.1 competence type IV pilus minor pilin ComGE Machinery gene
  LL223_RS11645 (LL223_2229) comGD 2260687..2261085 (-) 399 WP_021214886.1 competence type IV pilus minor pilin ComGD Machinery gene
  LL223_RS11650 (LL223_2230) comGC 2261078..2261347 (-) 270 WP_023349160.1 competence type IV pilus major pilin ComGC Machinery gene
  LL223_RS11655 (LL223_2231) - 2261494..2262018 (-) 525 WP_014570795.1 GNAT family N-acetyltransferase -
  LL223_RS11660 (LL223_2232) - 2262097..2262876 (-) 780 WP_058147788.1 peptidoglycan amidohydrolase family protein -
  LL223_RS11665 (LL223_2233) - 2262876..2263175 (-) 300 WP_031559226.1 phage holin -
  LL223_RS11670 (LL223_2234) - 2263188..2263538 (-) 351 WP_023349296.1 hypothetical protein -
  LL223_RS11675 (LL223_2235) - 2263558..2265612 (-) 2055 WP_373270652.1 collagen-like protein -

Sequence

Protein


Download         Length: 98 a.a.        Molecular weight: 11076.95 Da        Isoelectric Point: 6.4684

>NTDB_id=273783 LL223_RS11640 WP_010906316.1 2260419..2260715(-) (comGE) [Lactococcus lactis subsp. lactis strain 223]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=273783 LL223_RS11640 WP_010906316.1 2260419..2260715(-) (comGE) [Lactococcus lactis subsp. lactis strain 223]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA

Domains

Predicted by InterProScan.

Type II secretory pathway pseudopilin (ComGE)

(13-94)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB Q9CDU2

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

68.041

98.98

0.673