Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   C2H95_RS05280 Genome accession   NZ_CP026037
Coordinates   1037567..1037689 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain PK5_17     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 1032567..1042689
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  C2H95_RS05265 (C2H95_05250) yclJ 1034181..1034864 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  C2H95_RS05270 (C2H95_05255) yclK 1034851..1036272 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  C2H95_RS05275 (C2H95_05260) rapC 1036435..1037583 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  C2H95_RS05280 (C2H95_05265) phrC 1037567..1037689 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  C2H95_RS05285 (C2H95_05270) yczM 1037789..1037878 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  C2H95_RS05290 (C2H95_05275) yczN 1037960..1038073 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  C2H95_RS05295 (C2H95_05280) thrD 1038226..1039590 (-) 1365 WP_072173982.1 aspartate kinase -
  C2H95_RS05300 (C2H95_05285) ceuB 1039975..1040925 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  C2H95_RS05305 (C2H95_05290) yclO 1040918..1041865 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  C2H95_RS05310 (C2H95_05295) yclP 1041859..1042617 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=265682 C2H95_RS05280 WP_003224994.1 1037567..1037689(+) (phrC) [Bacillus subtilis strain PK5_17]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=265682 C2H95_RS05280 WP_003224994.1 1037567..1037689(+) (phrC) [Bacillus subtilis strain PK5_17]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment