Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   BS11774_RS08085 Genome accession   NZ_CP026010
Coordinates   1549542..1549664 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain ATCC 11774     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 1544542..1554664
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  BS11774_RS08070 (BS11774_08030) yclJ 1546156..1546839 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  BS11774_RS08075 (BS11774_08035) yclK 1546826..1548247 (+) 1422 WP_128473593.1 two-component system sensor histidine kinase YclK -
  BS11774_RS08080 (BS11774_08040) rapC 1548410..1549558 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  BS11774_RS08085 (BS11774_08045) phrC 1549542..1549664 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  BS11774_RS08090 (BS11774_08050) yczM 1549764..1549853 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  BS11774_RS08095 (BS11774_08055) yczN 1549935..1550048 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  BS11774_RS08100 (BS11774_08060) thrD 1550201..1551565 (-) 1365 WP_113713033.1 aspartate kinase -
  BS11774_RS08105 (BS11774_08065) ceuB 1551950..1552900 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  BS11774_RS08110 (BS11774_08070) yclO 1552893..1553840 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  BS11774_RS08115 (BS11774_08075) yclP 1553834..1554592 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=264972 BS11774_RS08085 WP_003224994.1 1549542..1549664(+) (phrC) [Bacillus subtilis strain ATCC 11774]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=264972 BS11774_RS08085 WP_003224994.1 1549542..1549664(+) (phrC) [Bacillus subtilis strain ATCC 11774]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment