Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   Bateq7PJ16_RS02405 Genome accession   NZ_CP023409
Coordinates   464437..464559 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain 7PJ-16     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 459437..469559
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  Bateq7PJ16_RS02390 (Bateq7PJ16_0445) yclJ 461051..461734 (+) 684 WP_128422071.1 two-component system response regulator YclJ -
  Bateq7PJ16_RS02395 (Bateq7PJ16_0446) yclK 461721..463142 (+) 1422 WP_159376644.1 two-component system sensor histidine kinase YclK -
  Bateq7PJ16_RS02400 (Bateq7PJ16_0447) rapC 463305..464453 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  Bateq7PJ16_RS02405 (Bateq7PJ16_0448) phrC 464437..464559 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  Bateq7PJ16_RS02410 (Bateq7PJ16_0449) yczM 464659..464748 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  Bateq7PJ16_RS02415 (Bateq7PJ16_0450) yczN 464830..464943 (-) 114 WP_032728921.1 YjcZ family sporulation protein -
  Bateq7PJ16_RS02420 (Bateq7PJ16_0451) thrD 465096..466460 (-) 1365 WP_159376645.1 aspartate kinase -
  Bateq7PJ16_RS02425 (Bateq7PJ16_0452) ceuB 466845..467795 (+) 951 WP_159376646.1 petrobactin ABC transporter permease YclN Machinery gene
  Bateq7PJ16_RS02430 (Bateq7PJ16_0453) yclO 467788..468735 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  Bateq7PJ16_RS02435 (Bateq7PJ16_0454) yclP 468729..469487 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=246764 Bateq7PJ16_RS02405 WP_003224994.1 464437..464559(+) (phrC) [Bacillus subtilis strain 7PJ-16]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=246764 Bateq7PJ16_RS02405 WP_003224994.1 464437..464559(+) (phrC) [Bacillus subtilis strain 7PJ-16]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCTGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment