Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   S101392_RS02280 Genome accession   NZ_CP021921
Coordinates   440477..440599 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain SRCM101392     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 435477..445599
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  S101392_RS02265 (S101392_00446) yclJ 437090..437773 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  S101392_RS02270 (S101392_00447) yclK 437760..439181 (+) 1422 WP_088325304.1 two-component system sensor histidine kinase YclK -
  S101392_RS02275 (S101392_00448) rapC 439345..440493 (+) 1149 WP_088325305.1 response regulator aspartate phosphatase RapC Regulator
  S101392_RS02280 (S101392_00449) phrC 440477..440599 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  S101392_RS02285 yczM 440699..440788 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  S101392_RS02290 (S101392_00450) yczN 440870..440983 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  S101392_RS02295 (S101392_00451) thrD 441137..442501 (-) 1365 WP_088325306.1 aspartate kinase -
  S101392_RS02300 (S101392_00452) ceuB 442886..443836 (+) 951 WP_088325307.1 petrobactin ABC transporter permease YclN Machinery gene
  S101392_RS02305 (S101392_00453) yclO 443829..444776 (+) 948 WP_088325308.1 petrobactin ABC transporter permease YclO -
  S101392_RS02310 (S101392_00454) yclP 444770..445528 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=234934 S101392_RS02280 WP_003224994.1 440477..440599(+) (phrC) [Bacillus subtilis subsp. subtilis strain SRCM101392]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=234934 S101392_RS02280 WP_003224994.1 440477..440599(+) (phrC) [Bacillus subtilis subsp. subtilis strain SRCM101392]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment