Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   S100333_RS02160 Genome accession   NZ_CP021892
Coordinates   425113..425235 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain SRCM100333     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 420113..430235
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  S100333_RS02145 yclJ 421727..422409 (+) 683 Protein_378 two-component system response regulator YclJ -
  S100333_RS02150 (S100333_00440) yclK 422396..423817 (+) 1422 WP_080317125.1 two-component system sensor histidine kinase YclK -
  S100333_RS02155 (S100333_00441) rapC 423981..425129 (+) 1149 WP_088272168.1 response regulator aspartate phosphatase RapC Regulator
  S100333_RS02160 (S100333_00442) phrC 425113..425235 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  S100333_RS02165 (S100333_00443) yczM 425335..425424 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  S100333_RS02170 (S100333_00444) yczN 425506..425619 (-) 114 WP_032728921.1 YjcZ family sporulation protein -
  S100333_RS02175 (S100333_00445) thrD 425772..427136 (-) 1365 WP_021481755.1 aspartate kinase -
  S100333_RS02180 (S100333_00447) ceuB 427527..428477 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  S100333_RS02185 (S100333_00448) yclO 428470..429417 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  S100333_RS02190 (S100333_00449) yclP 429411..430169 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=234506 S100333_RS02160 WP_003224994.1 425113..425235(+) (phrC) [Bacillus subtilis subsp. subtilis strain SRCM100333]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=234506 S100333_RS02160 WP_003224994.1 425113..425235(+) (phrC) [Bacillus subtilis subsp. subtilis strain SRCM100333]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment