Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   B9N48_RS02125 Genome accession   NZ_CP021169
Coordinates   420005..420127 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain TLO3     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 415005..425127
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  B9N48_RS02110 yclJ 416618..417301 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  B9N48_RS02115 yclK 417288..418709 (+) 1422 WP_086343454.1 two-component system sensor histidine kinase YclK -
  B9N48_RS02120 rapC 418873..420021 (+) 1149 WP_086343455.1 response regulator aspartate phosphatase RapC Regulator
  B9N48_RS02125 phrC 420005..420127 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  B9N48_RS02130 yczM 420225..420314 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  B9N48_RS02135 yczN 420396..420509 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  B9N48_RS02140 thrD 420662..422026 (-) 1365 WP_086343456.1 aspartate kinase -
  B9N48_RS02145 ceuB 422411..423361 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  B9N48_RS02150 yclO 423354..424301 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  B9N48_RS02155 yclP 424295..425053 (+) 759 WP_086343457.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=228740 B9N48_RS02125 WP_003224994.1 420005..420127(+) (phrC) [Bacillus subtilis strain TLO3]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=228740 B9N48_RS02125 WP_003224994.1 420005..420127(+) (phrC) [Bacillus subtilis strain TLO3]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment