Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   BSR08_RS20350 Genome accession   NZ_CP018184
Coordinates   3810642..3810764 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain KH2     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3805642..3815764
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  BSR08_RS20335 (BSR08_20615) yclJ 3807256..3807939 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  BSR08_RS20340 (BSR08_20620) yclK 3807926..3809347 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  BSR08_RS20345 (BSR08_20625) rapC 3809510..3810658 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  BSR08_RS20350 (BSR08_20630) phrC 3810642..3810764 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  BSR08_RS20355 (BSR08_20635) yczM 3810863..3810952 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  BSR08_RS20360 (BSR08_20640) yczN 3811034..3811147 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  BSR08_RS20365 (BSR08_20645) thrD 3811300..3812664 (-) 1365 WP_014478832.1 aspartate kinase -
  BSR08_RS20370 (BSR08_20650) ceuB 3813055..3814005 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  BSR08_RS20375 (BSR08_20655) yclO 3813998..3814945 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  BSR08_RS20380 (BSR08_20660) yclP 3814939..3815697 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=206746 BSR08_RS20350 WP_003224994.1 3810642..3810764(+) (phrC) [Bacillus subtilis strain KH2]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=206746 BSR08_RS20350 WP_003224994.1 3810642..3810764(+) (phrC) [Bacillus subtilis strain KH2]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment