Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   BKN48_RS12205 Genome accession   NZ_CP017676
Coordinates   2334567..2334689 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain VV2     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 2329567..2339689
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  BKN48_RS12190 (BKN48_12190) yclJ 2331180..2331863 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  BKN48_RS12195 (BKN48_12195) yclK 2331850..2333271 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  BKN48_RS12200 (BKN48_12200) rapC 2333435..2334583 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  BKN48_RS12205 (BKN48_12205) phrC 2334567..2334689 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  BKN48_RS20765 yczM 2334789..2334878 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  BKN48_RS12210 (BKN48_12210) yczN 2334960..2335073 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  BKN48_RS12215 (BKN48_12215) thrD 2335226..2336590 (-) 1365 WP_032726529.1 aspartate kinase -
  BKN48_RS12220 (BKN48_12220) ceuB 2336975..2337925 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  BKN48_RS12225 (BKN48_12225) yclO 2337918..2338865 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  BKN48_RS12230 (BKN48_12230) yclP 2338859..2339617 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=201507 BKN48_RS12205 WP_003224994.1 2334567..2334689(+) (phrC) [Bacillus subtilis strain VV2]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=201507 BKN48_RS12205 WP_003224994.1 2334567..2334689(+) (phrC) [Bacillus subtilis strain VV2]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment