Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   LL158_RS10560 Genome accession   NZ_CP015894
Coordinates   2074454..2074690 (-) Length   78 a.a.
NCBI ID   WP_014573335.1    Uniprot ID   -
Organism   Lactococcus cremoris strain 158     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Related MGE

Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type MGE coordinates Gene coordinates Relative position Distance (bp)
ICE 2069135..2073589 2074454..2074690 flank 865


Gene organization within MGE regions


Location: 2069135..2074690
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LL158_RS10530 (LL158_03375) - 2070648..2071457 (-) 810 WP_011677177.1 metal ABC transporter permease -
  LL158_RS10535 (LL158_03380) - 2071450..2072187 (-) 738 WP_015082929.1 metal ABC transporter ATP-binding protein -
  LL158_RS10540 (LL158_03385) - 2072366..2073208 (-) 843 WP_011677179.1 metal ABC transporter solute-binding protein, Zn/Mn family -
  LL158_RS10545 (LL158_03390) - 2073205..2073642 (-) 438 WP_011677180.1 zinc-dependent MarR family transcriptional regulator -
  LL158_RS10550 (LL158_03395) comGG 2073722..2074021 (-) 300 WP_011677181.1 competence type IV pilus minor pilin ComGG Machinery gene
  LL158_RS10555 (LL158_03400) comGF 2074045..2074470 (-) 426 WP_373467301.1 competence type IV pilus minor pilin ComGF Machinery gene
  LL158_RS10560 (LL158_03405) comGE 2074454..2074690 (-) 237 WP_014573335.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 78 a.a.        Molecular weight: 8700.94 Da        Isoelectric Point: 4.3885

>NTDB_id=182850 LL158_RS10560 WP_014573335.1 2074454..2074690(-) (comGE) [Lactococcus cremoris strain 158]
MALLSFLVTFLLSALTNSRQQEVQENQQIESLNVAQMAIESQLMELSLNGSVIKIRQDSTATIISDHGKEILRLEAQN

Nucleotide


Download         Length: 237 bp        

>NTDB_id=182850 LL158_RS10560 WP_014573335.1 2074454..2074690(-) (comGE) [Lactococcus cremoris strain 158]
ATGGCATTATTGAGCTTTTTGGTCACTTTTCTCTTAAGTGCTCTTACTAATTCTCGTCAGCAAGAGGTACAAGAAAATCA
ACAAATTGAGTCCTTAAATGTAGCTCAGATGGCAATAGAAAGTCAGCTGATGGAACTATCGTTAAATGGTTCTGTTATAA
AAATAAGACAAGATTCGACTGCAACCATTATTAGTGACCATGGAAAGGAAATTTTGCGACTTGAAGCTCAAAATTAG

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(1-74)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

96.154

100

0.962

Multiple sequence alignment