Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   A3772_RS02190 Genome accession   NZ_CP015004
Coordinates   429827..429949 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SZMC 6179J isolate B23     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 424827..434949
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  A3772_RS02175 (A3772_02175) yclJ 426441..427124 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  A3772_RS02180 (A3772_02180) yclK 427111..428532 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  A3772_RS02185 (A3772_02185) rapC 428695..429843 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  A3772_RS02190 (A3772_02190) phrC 429827..429949 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  A3772_RS22090 yczM 430049..430138 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  A3772_RS02195 (A3772_02195) yczN 430220..430333 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  A3772_RS02200 (A3772_02200) thrD 430487..431851 (-) 1365 WP_003234493.1 aspartate kinase -
  A3772_RS02205 (A3772_02205) ceuB 432236..433186 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  A3772_RS02210 (A3772_02210) yclO 433179..434126 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  A3772_RS02215 (A3772_02215) yclP 434120..434878 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=176017 A3772_RS02190 WP_003224994.1 429827..429949(+) (phrC) [Bacillus subtilis strain SZMC 6179J isolate B23]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=176017 A3772_RS02190 WP_003224994.1 429827..429949(+) (phrC) [Bacillus subtilis strain SZMC 6179J isolate B23]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment