Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   AT706_RS16420 Genome accession   NZ_CP013654
Coordinates   3192170..3192292 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain BSD-2     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3187170..3197292
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  AT706_RS16395 (AT706_16400) yclP 3187242..3188000 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  AT706_RS16400 (AT706_16405) yclO 3187994..3188941 (-) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  AT706_RS16405 (AT706_16410) ceuB 3188934..3189884 (-) 951 WP_015382768.1 petrobactin ABC transporter permease YclN Machinery gene
  AT706_RS16410 (AT706_16415) thrD 3190269..3191633 (+) 1365 WP_015382767.1 aspartate kinase -
  AT706_RS16415 (AT706_16420) yczN 3191786..3191899 (+) 114 WP_014478831.1 YjcZ family sporulation protein -
  AT706_RS21070 yczM 3191981..3192070 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  AT706_RS16420 (AT706_16425) phrC 3192170..3192292 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  AT706_RS16425 (AT706_16430) rapC 3192276..3193424 (-) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  AT706_RS16430 (AT706_16435) yclK 3193588..3195009 (-) 1422 WP_080030630.1 two-component system sensor histidine kinase YclK -
  AT706_RS16435 (AT706_16440) yclJ 3194996..3195679 (-) 684 WP_015482792.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=163553 AT706_RS16420 WP_003224994.1 3192170..3192292(-) (phrC) [Bacillus subtilis subsp. subtilis strain BSD-2]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=163553 AT706_RS16420 WP_003224994.1 3192170..3192292(-) (phrC) [Bacillus subtilis subsp. subtilis strain BSD-2]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment