Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   LLUC063_RS11030 Genome accession   NZ_CP015905
Coordinates   2169656..2169952 (-) Length   98 a.a.
NCBI ID   WP_010906316.1    Uniprot ID   Q9CDU2
Organism   Lactococcus lactis subsp. lactis strain UC063     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 2164656..2174952
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LLUC063_RS10995 (LLUC063_2145) - 2164762..2165571 (-) 810 WP_014570791.1 metal ABC transporter permease -
  LLUC063_RS11000 (LLUC063_2146) - 2165564..2166301 (-) 738 WP_058221575.1 metal ABC transporter ATP-binding protein -
  LLUC063_RS11005 (LLUC063_2147) - 2166478..2167320 (-) 843 WP_003129990.1 metal ABC transporter substrate-binding protein -
  LLUC063_RS11010 (LLUC063_2148) - 2167317..2167754 (-) 438 WP_003129992.1 zinc-dependent MarR family transcriptional regulator -
  LLUC063_RS11015 (LLUC063_2149) - 2167961..2168908 (+) 948 WP_003130410.1 IS30 family transposase -
  LLUC063_RS11020 (LLUC063_2150) comGG 2168882..2169208 (-) 327 WP_058221568.1 competence type IV pilus minor pilin ComGG Machinery gene
  LLUC063_RS11025 (LLUC063_2151) comGF 2169247..2169693 (-) 447 WP_058225890.1 competence type IV pilus minor pilin ComGF Machinery gene
  LLUC063_RS11030 (LLUC063_2152) comGE 2169656..2169952 (-) 297 WP_010906316.1 competence type IV pilus minor pilin ComGE Machinery gene
  LLUC063_RS11035 (LLUC063_2153) comGD 2169924..2170355 (-) 432 WP_080585155.1 competence type IV pilus minor pilin ComGD Machinery gene
  LLUC063_RS11040 (LLUC063_2154) comGC 2170315..2170584 (-) 270 WP_003129998.1 competence type IV pilus major pilin ComGC Machinery gene
  LLUC063_RS11045 (LLUC063_2155) - 2170758..2171225 (-) 468 WP_058225891.1 hypothetical protein -
  LLUC063_RS11050 (LLUC063_2156) - 2171308..2171481 (-) 174 WP_160321615.1 hypothetical protein -
  LLUC063_RS11055 (LLUC063_2157) - 2171568..2172347 (-) 780 WP_058225892.1 peptidoglycan amidohydrolase family protein -
  LLUC063_RS11060 (LLUC063_2158) - 2172347..2172634 (-) 288 WP_023164507.1 phage holin -
  LLUC063_RS11065 (LLUC063_2159) - 2172647..2172997 (-) 351 WP_058225893.1 hypothetical protein -
  LLUC063_RS11070 (LLUC063_2160) - 2173010..2173246 (-) 237 WP_081196280.1 hypothetical protein -

Sequence

Protein


Download         Length: 98 a.a.        Molecular weight: 11076.95 Da        Isoelectric Point: 6.4684

>NTDB_id=156100 LLUC063_RS11030 WP_010906316.1 2169656..2169952(-) (comGE) [Lactococcus lactis subsp. lactis strain UC063]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=156100 LLUC063_RS11030 WP_010906316.1 2169656..2169952(-) (comGE) [Lactococcus lactis subsp. lactis strain UC063]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA

Domains

Predicted by InterProScan.

Type II secretory pathway pseudopilin (ComGE)

(13-94)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB Q9CDU2

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

68.041

98.98

0.673