Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ABU16_RS07020 Genome accession   NZ_CP011882
Coordinates   1382594..1382716 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain TO-A JPC     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 1377594..1387716
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ABU16_RS07005 (ABU16_1379) yclJ 1379208..1379891 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ABU16_RS07010 (ABU16_1380) yclK 1379878..1381299 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  ABU16_RS07015 (ABU16_1381) rapC 1381462..1382610 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  ABU16_RS07020 (ABU16_1382) phrC 1382594..1382716 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ABU16_RS21565 (ABU16_1383) yczM 1382816..1382905 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ABU16_RS21570 (ABU16_1384) yczN 1382987..1383100 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  ABU16_RS07035 (ABU16_1385) thrD 1383254..1384618 (-) 1365 WP_003234493.1 aspartate kinase -
  ABU16_RS07040 (ABU16_1386) ceuB 1385003..1385953 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  ABU16_RS07045 (ABU16_1387) yclO 1385946..1386893 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  ABU16_RS07050 (ABU16_1388) yclP 1386887..1387645 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=149162 ABU16_RS07020 WP_003224994.1 1382594..1382716(+) (phrC) [Bacillus subtilis strain TO-A JPC]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=149162 ABU16_RS07020 WP_003224994.1 1382594..1382716(+) (phrC) [Bacillus subtilis strain TO-A JPC]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment