Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   ABA10_RS02155 Genome accession   NZ_CP011534
Coordinates   422231..422353 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain UD1022     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 417231..427353
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ABA10_RS02140 (ABA10_02140) yclJ 418845..419528 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  ABA10_RS02145 (ABA10_02145) yclK 419515..420936 (+) 1422 WP_080344153.1 two-component system sensor histidine kinase YclK -
  ABA10_RS02150 (ABA10_02150) rapC 421099..422247 (+) 1149 WP_015252823.1 response regulator aspartate phosphatase RapC Regulator
  ABA10_RS02155 (ABA10_02155) phrC 422231..422353 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ABA10_RS20760 (ABA10_02160) yczM 422453..422542 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ABA10_RS20765 (ABA10_02165) yczN 422626..422739 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  ABA10_RS02170 (ABA10_02170) thrD 422892..424256 (-) 1365 WP_047182090.1 aspartate kinase -
  ABA10_RS02175 (ABA10_02175) ceuB 424641..425591 (+) 951 WP_015382768.1 petrobactin ABC transporter permease YclN Machinery gene
  ABA10_RS02180 (ABA10_02180) yclO 425584..426531 (+) 948 WP_047182091.1 petrobactin ABC transporter permease YclO -
  ABA10_RS02185 (ABA10_02185) yclP 426525..427283 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=146713 ABA10_RS02155 WP_003224994.1 422231..422353(+) (phrC) [Bacillus subtilis strain UD1022]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=146713 ABA10_RS02155 WP_003224994.1 422231..422353(+) (phrC) [Bacillus subtilis strain UD1022]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment