Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   BIS30_RS12465 Genome accession   NZ_CP011051
Coordinates   2389929..2390051 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus spizizenii strain T30     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 2384929..2395051
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  BIS30_RS12450 (BIS30_12450) yclJ 2386544..2387227 (+) 684 WP_003224983.1 two-component system response regulator YclJ -
  BIS30_RS12455 (BIS30_12455) yclK 2387214..2388635 (+) 1422 WP_079996289.1 two-component system sensor histidine kinase YclK -
  BIS30_RS12460 (BIS30_12460) rapC 2388797..2389945 (+) 1149 WP_003224987.1 response regulator aspartate phosphatase RapC Regulator
  BIS30_RS12465 (BIS30_12465) phrC 2389929..2390051 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  BIS30_RS12470 (BIS30_12470) - 2390150..2390257 (-) 108 WP_003224996.1 YjcZ family sporulation protein -
  BIS30_RS12475 (BIS30_12475) - 2390406..2391770 (-) 1365 WP_003224998.1 aspartate kinase -
  BIS30_RS12480 (BIS30_12480) ceuB 2392155..2393105 (+) 951 WP_003225000.1 petrobactin ABC transporter permease YclN Machinery gene
  BIS30_RS12485 (BIS30_12485) yclO 2393098..2394045 (+) 948 WP_003225003.1 petrobactin ABC transporter permease YclO -
  BIS30_RS12490 (BIS30_12490) yclP 2394039..2394797 (+) 759 WP_003225005.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=141796 BIS30_RS12465 WP_003224994.1 2389929..2390051(+) (phrC) [Bacillus spizizenii strain T30]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=141796 BIS30_RS12465 WP_003224994.1 2389929..2390051(+) (phrC) [Bacillus spizizenii strain T30]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAACGC
GGAAGCACTCGACTTTCATGTGACGGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment