Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   QX56_RS02125 Genome accession   NZ_CP010053
Coordinates   429972..430094 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain PS832     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 424972..435094
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QX56_RS02110 (QX56_02170) yclJ 426586..427269 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  QX56_RS02115 (QX56_02175) yclK 427256..428677 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  QX56_RS02120 (QX56_02180) rapC 428840..429988 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  QX56_RS02125 (QX56_02185) phrC 429972..430094 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  QX56_RS21275 (QX56_02190) yczM 430194..430283 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  QX56_RS21280 (QX56_02195) yczN 430365..430478 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  QX56_RS02140 (QX56_02200) thrD 430632..431996 (-) 1365 WP_009966541.1 aspartate kinase -
  QX56_RS02145 (QX56_02205) ceuB 432381..433331 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  QX56_RS02150 (QX56_02210) yclO 433324..434271 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  QX56_RS02155 (QX56_02215) yclP 434265..435023 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=133841 QX56_RS02125 WP_003224994.1 429972..430094(+) (phrC) [Bacillus subtilis strain PS832]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=133841 QX56_RS02125 WP_003224994.1 429972..430094(+) (phrC) [Bacillus subtilis strain PS832]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment