Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   QF06_RS00850 Genome accession   NZ_CP010014
Coordinates   200675..200797 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. YP1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 195675..205797
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QF06_RS00835 (QF06_00835) yclJ 197288..197971 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  QF06_RS00840 (QF06_00840) yclK 197958..199379 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  QF06_RS00845 (QF06_00845) rapC 199543..200691 (+) 1149 WP_043940053.1 response regulator aspartate phosphatase RapC Regulator
  QF06_RS00850 (QF06_00850) phrC 200675..200797 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  QF06_RS20775 (QF06_00855) - 200899..200988 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  QF06_RS20780 (QF06_00860) - 201070..201183 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  QF06_RS00865 (QF06_00865) - 201337..202701 (-) 1365 WP_043940054.1 aspartate kinase -
  QF06_RS00870 (QF06_00870) ceuB 203086..204036 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  QF06_RS00875 (QF06_00875) yclO 204029..204976 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  QF06_RS00880 (QF06_00880) yclP 204970..205728 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=133530 QF06_RS00850 WP_003224994.1 200675..200797(+) (phrC) [Bacillus sp. YP1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=133530 QF06_RS00850 WP_003224994.1 200675..200797(+) (phrC) [Bacillus sp. YP1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment