Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   KJP75_RS02170 Genome accession   NZ_OX419560
Coordinates   428225..428347 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis isolate NRS6132     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 423225..433347
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  KJP75_RS02155 (NRS6132_02105) yclJ 424839..425522 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  KJP75_RS02160 (NRS6132_02110) yclK 425509..426930 (+) 1422 WP_113713032.1 two-component system sensor histidine kinase YclK -
  KJP75_RS02165 (NRS6132_02115) rapC 427093..428241 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  KJP75_RS02170 (NRS6132_02120) phrC 428225..428347 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  KJP75_RS02175 (NRS6132_02125) yczM 428447..428536 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  KJP75_RS02180 (NRS6132_02130) yczN 428618..428731 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  KJP75_RS02185 (NRS6132_02135) thrD 428885..430249 (-) 1365 WP_113713033.1 aspartate kinase -
  KJP75_RS02190 (NRS6132_02140) ceuB 430634..431584 (+) 951 WP_213384308.1 ABC transporter permease Machinery gene
  KJP75_RS02195 (NRS6132_02145) yclO 431577..432524 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  KJP75_RS02200 (NRS6132_02150) yclP 432518..433276 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1156885 KJP75_RS02170 WP_003224994.1 428225..428347(+) (phrC) [Bacillus subtilis isolate NRS6132]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1156885 KJP75_RS02170 WP_003224994.1 428225..428347(+) (phrC) [Bacillus subtilis isolate NRS6132]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment