Detailed information    

insolico Bioinformatically predicted

Overview


Name   comGE   Type   Machinery gene
Locus tag   LLA12_RS11725 Genome accession   NZ_LT599049
Coordinates   2381842..2382138 (-) Length   98 a.a.
NCBI ID   WP_021721871.1    Uniprot ID   -
Organism   Lactococcus lactis subsp. lactis strain A12     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Related MGE


Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type MGE coordinates Gene coordinates Relative position Distance (bp)
ICE 2376564..2381029 2381842..2382138 flank 813


Gene organization within MGE regions


Location: 2376564..2382138
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LLA12_RS11695 (LLA12_02480) - 2378036..2378845 (-) 810 WP_032946979.1 metal ABC transporter permease -
  LLA12_RS11700 (LLA12_02481) - 2378838..2379575 (-) 738 WP_021723055.1 metal ABC transporter ATP-binding protein -
  LLA12_RS11705 (LLA12_02482) - 2379753..2380595 (-) 843 WP_068872849.1 metal ABC transporter substrate-binding protein -
  LLA12_RS11710 (LLA12_02483) - 2380592..2381029 (-) 438 WP_021721874.1 zinc-dependent MarR family transcriptional regulator -
  LLA12_RS11715 (LLA12_02484) comGG 2381110..2381385 (-) 276 WP_021721873.1 hypothetical protein Machinery gene
  LLA12_RS11720 (LLA12_02485) comGF 2381433..2381879 (-) 447 WP_021721872.1 competence type IV pilus minor pilin ComGF Machinery gene
  LLA12_RS11725 (LLA12_02486) comGE 2381842..2382138 (-) 297 WP_021721871.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence


Protein


Download         Length: 98 a.a.        Molecular weight: 10930.66 Da        Isoelectric Point: 6.4665

>NTDB_id=1144888 LLA12_RS11725 WP_021721871.1 2381842..2382138(-) (comGE) [Lactococcus lactis subsp. lactis strain A12]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLAQARQKNTEENQKIEALNVAQMAIESHLTELSINGSDIKINENSN
LLIISNHGKEILRLEPQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=1144888 LLA12_RS11725 WP_021721871.1 2381842..2382138(-) (comGE) [Lactococcus lactis subsp. lactis strain A12]
GTGGAAAATTTAAAAAGAAAATCAGTTAAAGCTTATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGCGCAAGCAAGACAAAAAAATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATTAACGGTTCTGATATAAAGATAAATGAAAACTCAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTTTGCGACTTGAACCTCAAAGTTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

70.103

98.98

0.694


Multiple sequence alignment