Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ACL6ER_RS01135 Genome accession   NZ_CP178717
Coordinates   255622..255744 (+) Length   40 a.a.
NCBI ID   WP_003240188.1    Uniprot ID   A0A9Q4EQJ2
Organism   Bacillus inaquosorum strain SY1167     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 250622..260744
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACL6ER_RS01120 (ACL6ER_01120) yclJ 252242..252925 (+) 684 WP_003240180.1 two-component system response regulator YclJ -
  ACL6ER_RS01125 (ACL6ER_01125) yclK 252912..254327 (+) 1416 WP_268285109.1 two-component system sensor histidine kinase YclK -
  ACL6ER_RS01130 (ACL6ER_01130) rapC 254490..255638 (+) 1149 WP_019257465.1 response regulator aspartate phosphatase RapC Regulator
  ACL6ER_RS01135 (ACL6ER_01135) phrC 255622..255744 (+) 123 WP_003240188.1 phosphatase RapC inhibitor PhrC Regulator
  ACL6ER_RS01140 (ACL6ER_01140) - 255840..255947 (-) 108 WP_019257466.1 YjcZ family sporulation protein -
  ACL6ER_RS01145 (ACL6ER_01145) - 256090..257463 (-) 1374 WP_225516446.1 aspartate kinase -
  ACL6ER_RS01150 (ACL6ER_01150) ceuB 257847..258797 (+) 951 WP_003240192.1 petrobactin ABC transporter permease YclN Machinery gene
  ACL6ER_RS01155 (ACL6ER_01155) yclO 258790..259737 (+) 948 WP_060397923.1 petrobactin ABC transporter permease YclO -
  ACL6ER_RS01160 (ACL6ER_01160) yclP 259731..260489 (+) 759 WP_003240196.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4242.04 Da        Isoelectric Point: 8.0285

>NTDB_id=1090815 ACL6ER_RS01135 WP_003240188.1 255622..255744(+) (phrC) [Bacillus inaquosorum strain SY1167]
MKLKSKLFVICLAAAAIFTVAGVSANAESLDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1090815 ACL6ER_RS01135 WP_003240188.1 255622..255744(+) (phrC) [Bacillus inaquosorum strain SY1167]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGTGGCTGGCGTTTCTGCTAACGC
CGAATCACTCGACTTTCATGTAACGGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

95

100

0.95

Multiple sequence alignment