Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   ABFT42_RS12380 Genome accession   NZ_CP178596
Coordinates   2389022..2389195 (+) Length   57 a.a.
NCBI ID   WP_339190978.1    Uniprot ID   -
Organism   Bacillus mojavensis strain C3     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 2384022..2394195
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ABFT42_RS12365 (ABFT42_12365) gcvT 2384822..2385910 (-) 1089 WP_413286392.1 glycine cleavage system aminomethyltransferase GcvT -
  ABFT42_RS12370 (ABFT42_12370) - 2386354..2388027 (+) 1674 WP_268504993.1 DEAD/DEAH box helicase -
  ABFT42_RS12375 (ABFT42_12375) - 2388048..2388842 (+) 795 WP_168748226.1 YqhG family protein -
  ABFT42_RS12380 (ABFT42_12380) sinI 2389022..2389195 (+) 174 WP_339190978.1 anti-repressor SinI Regulator
  ABFT42_RS12385 (ABFT42_12385) sinR 2389229..2389564 (+) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  ABFT42_RS12390 (ABFT42_12390) tasA 2389652..2390437 (-) 786 WP_010334917.1 biofilm matrix protein TasA -
  ABFT42_RS12395 (ABFT42_12395) sipW 2390502..2391086 (-) 585 WP_339190980.1 signal peptidase I SipW -
  ABFT42_RS12400 (ABFT42_12400) tapA 2391058..2391819 (-) 762 WP_413286393.1 amyloid fiber anchoring/assembly protein TapA -
  ABFT42_RS12405 (ABFT42_12405) - 2392096..2392419 (+) 324 WP_168748230.1 YqzG/YhdC family protein -
  ABFT42_RS12410 (ABFT42_12410) - 2392462..2392641 (-) 180 WP_003236949.1 YqzE family protein -
  ABFT42_RS12415 (ABFT42_12415) comGG 2392713..2393087 (-) 375 WP_339177153.1 competence type IV pilus minor pilin ComGG Machinery gene
  ABFT42_RS12420 (ABFT42_12420) comGF 2393088..2393495 (-) 408 WP_413286394.1 competence type IV pilus minor pilin ComGF Machinery gene
  ABFT42_RS12425 (ABFT42_12425) comGE 2393497..2393844 (-) 348 WP_268451134.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6669.59 Da        Isoelectric Point: 6.4604

>NTDB_id=1090314 ABFT42_RS12380 WP_339190978.1 2389022..2389195(+) (sinI) [Bacillus mojavensis strain C3]
MKNAKQEHFELDQEWVELMLEAREANISPEEIRKYLLLNKKSAYPGPAARSHTVNPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=1090314 ABFT42_RS12380 WP_339190978.1 2389022..2389195(+) (sinI) [Bacillus mojavensis strain C3]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTGGATCAAGAATGGGTTGAATTAATGCTGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTTATCCTGGTCCGGCAGCCAGAAGTCATACCG
TAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947

Multiple sequence alignment