Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   ACLZ2J_RS02165 Genome accession   NZ_CP178514
Coordinates   429502..429624 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain BS18-1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 424502..434624
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACLZ2J_RS02150 yclJ 426116..426799 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ACLZ2J_RS02155 yclK 426786..428207 (+) 1422 WP_413155104.1 two-component system sensor histidine kinase YclK -
  ACLZ2J_RS02160 rapC 428370..429518 (+) 1149 WP_024571686.1 response regulator aspartate phosphatase RapC Regulator
  ACLZ2J_RS02165 phrC 429502..429624 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ACLZ2J_RS02170 yczM 429724..429813 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ACLZ2J_RS02175 yczN 429895..430008 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  ACLZ2J_RS02180 thrD 430161..431525 (-) 1365 WP_413155106.1 aspartate kinase -
  ACLZ2J_RS02185 ceuB 431910..432860 (+) 951 WP_262120201.1 petrobactin ABC transporter permease YclN Machinery gene
  ACLZ2J_RS02190 yclO 432853..433800 (+) 948 WP_343515538.1 petrobactin ABC transporter permease YclO -
  ACLZ2J_RS02195 yclP 433794..434552 (+) 759 WP_341283370.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1089772 ACLZ2J_RS02165 WP_003224994.1 429502..429624(+) (phrC) [Bacillus subtilis strain BS18-1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1089772 ACLZ2J_RS02165 WP_003224994.1 429502..429624(+) (phrC) [Bacillus subtilis strain BS18-1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment