Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ACLII2_RS20025 Genome accession   NZ_CP178213
Coordinates   3787343..3787465 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain BM107     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3782343..3792465
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACLII2_RS19995 yclP 3782414..3783172 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  ACLII2_RS20000 yclO 3783166..3784113 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  ACLII2_RS20005 ceuB 3784106..3785056 (-) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  ACLII2_RS20010 thrD 3785441..3786805 (+) 1365 WP_003234493.1 aspartate kinase -
  ACLII2_RS20015 yczN 3786959..3787072 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  ACLII2_RS20020 yczM 3787154..3787243 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  ACLII2_RS20025 phrC 3787343..3787465 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ACLII2_RS20030 rapC 3787449..3788597 (-) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  ACLII2_RS20035 yclK 3788760..3790181 (-) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  ACLII2_RS20040 yclJ 3790168..3790851 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1088338 ACLII2_RS20025 WP_003224994.1 3787343..3787465(-) (phrC) [Bacillus subtilis subsp. subtilis strain BM107]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1088338 ACLII2_RS20025 WP_003224994.1 3787343..3787465(-) (phrC) [Bacillus subtilis subsp. subtilis strain BM107]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment