Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   ACK3B6_RS12605 Genome accession   NZ_CP176792
Coordinates   2498749..2498922 (+) Length   57 a.a.
NCBI ID   WP_024122036.1    Uniprot ID   -
Organism   Bacillus halotolerans strain BCP32     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 2493749..2503922
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACK3B6_RS12590 (ACK3B6_12590) gcvT 2494546..2495634 (-) 1089 WP_105991982.1 glycine cleavage system aminomethyltransferase GcvT -
  ACK3B6_RS12595 (ACK3B6_12595) - 2496078..2497751 (+) 1674 WP_059293610.1 DEAD/DEAH box helicase -
  ACK3B6_RS12600 (ACK3B6_12600) - 2497771..2498565 (+) 795 WP_105955581.1 YqhG family protein -
  ACK3B6_RS12605 (ACK3B6_12605) sinI 2498749..2498922 (+) 174 WP_024122036.1 anti-repressor SinI Regulator
  ACK3B6_RS12610 (ACK3B6_12610) sinR 2498956..2499291 (+) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  ACK3B6_RS12615 (ACK3B6_12615) tasA 2499378..2500163 (-) 786 WP_105955580.1 biofilm matrix protein TasA -
  ACK3B6_RS12620 (ACK3B6_12620) sipW 2500228..2500812 (-) 585 WP_105955579.1 signal peptidase I SipW -
  ACK3B6_RS12625 (ACK3B6_12625) tapA 2500784..2501545 (-) 762 WP_105955621.1 amyloid fiber anchoring/assembly protein TapA -
  ACK3B6_RS12630 (ACK3B6_12630) - 2501822..2502145 (+) 324 WP_024122040.1 YqzG/YhdC family protein -
  ACK3B6_RS12635 (ACK3B6_12635) - 2502188..2502367 (-) 180 WP_003236949.1 YqzE family protein -
  ACK3B6_RS12640 (ACK3B6_12640) comGG 2502439..2502813 (-) 375 WP_101864528.1 competence type IV pilus minor pilin ComGG Machinery gene
  ACK3B6_RS12645 (ACK3B6_12645) comGF 2502814..2503197 (-) 384 WP_181185692.1 competence type IV pilus minor pilin ComGF Machinery gene
  ACK3B6_RS12650 (ACK3B6_12650) comGE 2503223..2503570 (-) 348 WP_105955577.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6675.62 Da        Isoelectric Point: 6.7231

>NTDB_id=1083000 ACK3B6_RS12605 WP_024122036.1 2498749..2498922(+) (sinI) [Bacillus halotolerans strain BCP32]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=1083000 ACK3B6_RS12605 WP_024122036.1 2498749..2498922(+) (sinI) [Bacillus halotolerans strain BCP32]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947

Multiple sequence alignment